View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0775_low_51 (Length: 274)
Name: NF0775_low_51
Description: NF0775
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0775_low_51 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 137; Significance: 1e-71; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 137; E-Value: 1e-71
Query Start/End: Original strand, 84 - 231
Target Start/End: Complemental strand, 15595987 - 15595839
Alignment:
| Q |
84 |
taccaactccggctacgatgagaatatccaagaggtcgattt-acttgcaatgtttttgagagtgaaatgtgaaggagcgacgggaacgagggccgtgga |
182 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15595987 |
taccaactccggctacgatgagaatatccaagaggtcgatttgacttgcaatgtttttgagagtgaaatgtgaaggagcgacgggaacgagggccgtgga |
15595888 |
T |
|
| Q |
183 |
aacagaatcagaagaagaatcctcttcacgagaagatttattaccgtcg |
231 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15595887 |
aacagagtcagaagaagaatcctcttcacgagaagatttattaccgtcg |
15595839 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 6411 times since January 2019
Visitors: 5768