View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0775_low_6 (Length: 452)
Name: NF0775_low_6
Description: NF0775
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0775_low_6 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 122; Significance: 2e-62; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 122; E-Value: 2e-62
Query Start/End: Original strand, 103 - 232
Target Start/End: Original strand, 29009143 - 29009272
Alignment:
| Q |
103 |
taatcaagaagttgaagcgaacatatatgatctttgcgcggttgaagagtttgttatgaattcagaacagagaatttggttatgtacctgcaaattcaga |
202 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
29009143 |
taatcaagaagttgaagcgaacctatatgatctttgcgcggttgaagagtttgttatgaattcagaacagagaatgtggttatgtacctgcaaattcaga |
29009242 |
T |
 |
| Q |
203 |
aagtgaaatctcagagcaatgaagaagaag |
232 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
29009243 |
aagtgaaatctcagagcaatgaagaagaag |
29009272 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 72; E-Value: 1e-32
Query Start/End: Original strand, 350 - 425
Target Start/End: Original strand, 29009481 - 29009556
Alignment:
| Q |
350 |
agggttttcgcgcctttatacagagtgatgagaattttggtttcgttttctgttatggagagtaaacttgtctgtg |
425 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
29009481 |
agggttttcgcgcctttatacagagtgatgagaattttggtttcgttttctgttacggagagtaaacttgtctgtg |
29009556 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University