View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0775_low_70 (Length: 233)
Name: NF0775_low_70
Description: NF0775
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0775_low_70 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 88; Significance: 2e-42; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 88; E-Value: 2e-42
Query Start/End: Original strand, 10 - 109
Target Start/End: Complemental strand, 35472902 - 35472803
Alignment:
| Q |
10 |
gtaatgtgtctgtaaagaacaaaggaatccataaataagaatggaaacgtttcagaggacaggatcccgatagtgatatcttggtctgggatattgttgg |
109 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
35472902 |
gtaatgtgtctgtcaagaacaaaggaatccataaataagaatggaaacgtttcagaggacaggatcccgatagtgatatcttggtctgggactttgttgg |
35472803 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 7052 times since January 2019
Visitors: 5773