View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0775_low_72 (Length: 228)

Name: NF0775_low_72
Description: NF0775
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0775_low_72
NF0775_low_72
[»] chr4 (1 HSPs)
chr4 (1-114)||(35508066-35508179)


Alignment Details
Target: chr4 (Bit Score: 98; Significance: 2e-48; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 98; E-Value: 2e-48
Query Start/End: Original strand, 1 - 114
Target Start/End: Original strand, 35508066 - 35508179
Alignment:
1 gtgtttggaagcttcacaccatgccgcccagaagtgaagccccgccggagaaccgccgcgaacaacctcatccaactccgactttgacttcacgtctcgc 100  Q
    ||||||||||||||||||||||| |||||||||||||||| |||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||    
35508066 gtgtttggaagcttcacaccatgacgcccagaagtgaagcaccgccggagaaccgccgcgaaccacctcatccaactccgactttgacttcacgtctcgc 35508165  T
101 accgaaccccccat 114  Q
    |||||||| |||||    
35508166 accgaaccacccat 35508179  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 5852 times since January 2019
Visitors: 5760