View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0775_low_74 (Length: 220)
Name: NF0775_low_74
Description: NF0775
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0775_low_74 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 193; Significance: 1e-105; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 1 - 220
Target Start/End: Complemental strand, 3829482 - 3829261
Alignment:
| Q |
1 |
taaccacacaccgtaaatccacaatcacaataacaaataaaaagtaggaattgaaaatgagaaaatcttacgacacttttaaaatatgaagtcgttacaa |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3829482 |
taaccacacaccgtaaatccacaatcacaataataaataaaaagtaggaattaaaaatgagaaaatcttacgacacttttaaaatatgaagtcgttacaa |
3829383 |
T |
 |
| Q |
101 |
gagcaattataatcctttgatattaacttttacaatttttggattacaaatagtatacttattgtaactccaaattttcataa---tgtcataattttat |
197 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
3829382 |
gagcaattataatcctttgatattaacttttacaatttttggattac-aatagtatacttattgtaactccaaattttcataatggtgtcataattttat |
3829284 |
T |
 |
| Q |
198 |
ttgttatgaatttaaatgttttt |
220 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
3829283 |
ttgttatgaatttaaatgttttt |
3829261 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University