View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0775_low_78 (Length: 212)
Name: NF0775_low_78
Description: NF0775
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0775_low_78 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 99; Significance: 5e-49; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 99; E-Value: 5e-49
Query Start/End: Original strand, 1 - 107
Target Start/End: Complemental strand, 47286909 - 47286803
Alignment:
| Q |
1 |
ttcgatcgaaccgattttggcccttcaaatctccctctttcaaatggccggtgtcgtatggatccattcgacactgcccttaaaattgattgcactactc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
47286909 |
ttcgatcgaaccgattttggcccttcaaatctccctctttcaaatggccggtgtcgtatggatccattcgacactgcccttaaaattgattgcactgctc |
47286810 |
T |
|
| Q |
101 |
aatctgt |
107 |
Q |
| |
|
| ||||| |
|
|
| T |
47286809 |
actctgt |
47286803 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 5931 times since January 2019
Visitors: 5761