View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0775_low_79 (Length: 211)
Name: NF0775_low_79
Description: NF0775
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0775_low_79 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 85; Significance: 1e-40; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 85; E-Value: 1e-40
Query Start/End: Original strand, 1 - 97
Target Start/End: Original strand, 35508083 - 35508179
Alignment:
Q |
1 |
accatgacgcccagaagtgaagccccgccggagaaccgccgcgaacaacctcatccaactccgactttgacttcacgtctcgcaccgaaccccccat |
97 |
Q |
|
|
||||||||||||||||||||||| |||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
T |
35508083 |
accatgacgcccagaagtgaagcaccgccggagaaccgccgcgaaccacctcatccaactccgactttgacttcacgtctcgcaccgaaccacccat |
35508179 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University