View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0775_low_84 (Length: 205)
Name: NF0775_low_84
Description: NF0775
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0775_low_84 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 46; Significance: 2e-17; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 125 - 174
Target Start/End: Original strand, 22193225 - 22193274
Alignment:
| Q |
125 |
attaattgtctactttttaaaatcatttcgtttaatatacacaaatgttt |
174 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
22193225 |
attaattgtctacttttttaaatcatttcgtttaatatacacaaatgttt |
22193274 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 1 - 49
Target Start/End: Original strand, 22193101 - 22193149
Alignment:
| Q |
1 |
taatattcagatccatggttttttattacgcgaagatattcctttgtgg |
49 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
22193101 |
taatattcagatccatggttttttattatgcgaagatattcctttgtgg |
22193149 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 6978 times since January 2019
Visitors: 5773