View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0775_low_84 (Length: 205)

Name: NF0775_low_84
Description: NF0775
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0775_low_84
NF0775_low_84
[»] chr3 (2 HSPs)
chr3 (125-174)||(22193225-22193274)
chr3 (1-49)||(22193101-22193149)


Alignment Details
Target: chr3 (Bit Score: 46; Significance: 2e-17; HSPs: 2)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 125 - 174
Target Start/End: Original strand, 22193225 - 22193274
Alignment:
125 attaattgtctactttttaaaatcatttcgtttaatatacacaaatgttt 174  Q
    |||||||||||||||||| |||||||||||||||||||||||||||||||    
22193225 attaattgtctacttttttaaatcatttcgtttaatatacacaaatgttt 22193274  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 1 - 49
Target Start/End: Original strand, 22193101 - 22193149
Alignment:
1 taatattcagatccatggttttttattacgcgaagatattcctttgtgg 49  Q
    |||||||||||||||||||||||||||| ||||||||||||||||||||    
22193101 taatattcagatccatggttttttattatgcgaagatattcctttgtgg 22193149  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 6978 times since January 2019
Visitors: 5773