View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0775_low_86 (Length: 202)

Name: NF0775_low_86
Description: NF0775
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0775_low_86
NF0775_low_86
[»] chr1 (1 HSPs)
chr1 (174-202)||(39955073-39955101)


Alignment Details
Target: chr1 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 174 - 202
Target Start/End: Complemental strand, 39955101 - 39955073
Alignment:
174 cctcaacttcattacttcattgcaaatgg 202  Q
    |||||||||||||||||||||||||||||    
39955101 cctcaacttcattacttcattgcaaatgg 39955073  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University