View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0777_high_8 (Length: 428)
Name: NF0777_high_8
Description: NF0777
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0777_high_8 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 291; Significance: 1e-163; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 291; E-Value: 1e-163
Query Start/End: Original strand, 30 - 413
Target Start/End: Complemental strand, 43091600 - 43091217
Alignment:
| Q |
30 |
tttacttcttcttcatttctcttactcttcaagttagctatagaaccattactagatttcatggcctttgaatttgaagtgggtttagtacaannnnnnn |
129 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
43091600 |
tttacttcttcttcatttctcttactcttcaagttagctatagaaccattactagatttcatggcctttgaatttgaagtgggtttagcacaattttttt |
43091501 |
T |
|
| Q |
130 |
ggttatgaggaacatattgatgatctttgaagggaatgagtttgccacagaagattatgttgtcatgaattgttgaagtgttgaattcttcactgaaaaa |
229 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43091500 |
ggttatgaggaacatattgatgatctttgaagggaatgagtttgccacagaagattatgttgtcatgaattgttgaagtgttgaattcttcactgaaaaa |
43091401 |
T |
|
| Q |
230 |
ctcaaacaagttnnnnnnnnnnnnnnnnnnnnggtgatccttgccataattggaaaaatcacctcgttgaggtgaaattgtggaatttggaaggtcacaa |
329 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
43091400 |
ctcaaacaagttatcatcatcatcatcatcatggtgatccttgccataattggaaaaatcaccccgttgaggtgaaattgtggaatttggaaggtcacaa |
43091301 |
T |
|
| Q |
330 |
agtgataaagtttcttcttcttcataatcatcatactcatcttgtagcaaagtactttcttcattccctacttcttcatgtgag |
413 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
43091300 |
agtgataaagtttcttcttcttcataatcatcatactcatcttgtagcaaagtactttcttcattccctacttcttgatgtgag |
43091217 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 4709 times since January 2019
Visitors: 5752