View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0777_low_28 (Length: 297)
Name: NF0777_low_28
Description: NF0777
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0777_low_28 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 259; Significance: 1e-144; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 259; E-Value: 1e-144
Query Start/End: Original strand, 10 - 276
Target Start/End: Original strand, 45271908 - 45272174
Alignment:
| Q |
10 |
attattctaaatatgatcaaatagtattacatacatttagctaccagtatatgtggattcagaagaaattgaacccaaaaatgcctagaaattcccaaac |
109 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
45271908 |
attattctaaatatgatcaaatagtattacatacatttagctaccagtatatgtggattcagaagaaattgaaccaaaaaatgcctagaaattcccaaac |
45272007 |
T |
|
| Q |
110 |
aaagaaacacttatttctaagttattatataattaatgtgtcttcaacattcgttctagcaggaactaatgtattaatcaatgatccgcaagaagttttc |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45272008 |
aaagaaacacttatttctaagttattatataattaatgtgtcttcaacattcgttctagcagcaactaatgtattaatcaatgatccgcaagaagttttc |
45272107 |
T |
|
| Q |
210 |
ttctatcattgccagcgcaggccatcattttgttcatgctattcttctgcagattcttaacgttgag |
276 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45272108 |
ttctatcattgccagcgcaggccatcattttgttcatgctattcttctgcagattcttaacgttgag |
45272174 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 6857 times since January 2019
Visitors: 5772