View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0777_low_30 (Length: 291)
Name: NF0777_low_30
Description: NF0777
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0777_low_30 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 103; Significance: 3e-51; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 103; E-Value: 3e-51
Query Start/End: Original strand, 76 - 182
Target Start/End: Original strand, 32994744 - 32994850
Alignment:
Q |
76 |
tgtttttcatgatcagctcctatccttgagagatcaaagagtgacaaattaaggtacctcttggttcctaaatactctcatgaatctgattatgagcaat |
175 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
T |
32994744 |
tgtttttcatgatcagctcctatccttgagagatcaaagagtgacaaattaaggtacctcttggttcctcaatactctcatgaatctgattatgagcaat |
32994843 |
T |
 |
Q |
176 |
gtttcac |
182 |
Q |
|
|
||||||| |
|
|
T |
32994844 |
gtttcac |
32994850 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 26 times since January 2019
Visitors: 5776