View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0777_low_35 (Length: 274)
Name: NF0777_low_35
Description: NF0777
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0777_low_35 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 87; Significance: 9e-42; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 87; E-Value: 9e-42
Query Start/End: Original strand, 34 - 183
Target Start/End: Original strand, 31705797 - 31705947
Alignment:
| Q |
34 |
ttattattcttctctactaccacttgagtaaccaaaattaataagaacannnnnnnnnnaa--aataatactgattaatggagtgagtagtaaataaatg |
131 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| | |||||||||||||||||||| |||||||||||||||| |
|
|
| T |
31705797 |
ttattattcttctctactaccacttgagtaaccaaaattaataagaacattttcttttttataaataatactgattaatggagcgagtagtaaataaatg |
31705896 |
T |
 |
| Q |
132 |
aaagaactattaatcaaaaaacacattccaccttggagggagtatattgttg |
183 |
Q |
| |
|
||||||||||||||| |||||||||||||||| |||||||||||||||||| |
|
|
| T |
31705897 |
aaagaactattaatc-caaaacacattccacctcggagggagtatattgttg |
31705947 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University