View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0777_low_38 (Length: 251)
Name: NF0777_low_38
Description: NF0777
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0777_low_38 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 201; Significance: 1e-110; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 1 - 241
Target Start/End: Original strand, 4074249 - 4074500
Alignment:
Q |
1 |
ctttcttatataataattcaaaatataatttggggtccaaattgttcatgaaatacaatattaaaattgttgtcttctactttacattcagttttcctag |
100 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
T |
4074249 |
ctttcttatataataattcaaaatataatttggggtccaaattgttcatgaaatacaatatcaaaattgttgtcttctactttacattcagttttcctag |
4074348 |
T |
 |
Q |
101 |
atgtgatagttggtg-aaaaaagggagcatctatgcttctaaaaacttcaactttaggtgcttc----------caggaggtaaattaagtctagcaaat |
189 |
Q |
|
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
T |
4074349 |
atgtgatagttggtgaaaaaaagggagcatctatgcttctaaaaacttcaactttaggtgcttcaaagtttggtcaggaggtaaattaagtctagcaaat |
4074448 |
T |
 |
Q |
190 |
gattgttccagttgggatatgaacttctactatcgatttgtcaatctctgtg |
241 |
Q |
|
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
T |
4074449 |
gattgttccagttgggatatgaacttctcctatcgatttgtcaatctctgtg |
4074500 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 12 times since January 2019
Visitors: 5776