View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0777_low_41 (Length: 246)
Name: NF0777_low_41
Description: NF0777
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0777_low_41 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 112; Significance: 1e-56; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 112; E-Value: 1e-56
Query Start/End: Original strand, 4 - 135
Target Start/End: Complemental strand, 32701704 - 32701573
Alignment:
| Q |
4 |
atttcatttcatttactcatttagcaattttatgctgcaaattttattgacttgggtataagcttaccccaacaagcaacaaccatataacagcacatgt |
103 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| || |||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
32701704 |
atttcatttcatttactcatttagcaattttatgctgcaaattttattgagctgtgtataagcttaccccaacaagcaacaaccatacaacagcacatgt |
32701605 |
T |
|
| Q |
104 |
tatttgttctcaacacacaatcacaacacagg |
135 |
Q |
| |
|
||||||||| |||||||||||||||||||||| |
|
|
| T |
32701604 |
tatttgttcccaacacacaatcacaacacagg |
32701573 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 5943 times since January 2019
Visitors: 5761