View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0777_low_42 (Length: 245)
Name: NF0777_low_42
Description: NF0777
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0777_low_42 |
 |  |
|
[»] scaffold0276 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0276 (Bit Score: 116; Significance: 4e-59; HSPs: 1)
Name: scaffold0276
Description:
Target: scaffold0276; HSP #1
Raw Score: 116; E-Value: 4e-59
Query Start/End: Original strand, 1 - 143
Target Start/End: Original strand, 8667 - 8816
Alignment:
Q |
1 |
acgacgatgacaggaaagaataggacaaaactttaataaaaggtattttcaattaatagtttcctgcagaaatgcttttatcaataatttgctttatacg |
100 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
8667 |
acgacgatgacaggaaagaataggacaaaactttaataaaaggtagtttcaattaataatttcctgcagaaatgcttttatcaataatttgctttatacg |
8766 |
T |
 |
Q |
101 |
gtcgtactccttgc-------ttgtgattatatttagcgggtggggattg |
143 |
Q |
|
|
|||||||||||||| ||||||||||||||||||||||||||||| |
|
|
T |
8767 |
gtcgtactccttgcttgtgaattgtgattatatttagcgggtggggattg |
8816 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University