View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0777_low_44 (Length: 229)
Name: NF0777_low_44
Description: NF0777
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0777_low_44 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 118; Significance: 2e-60; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 118; E-Value: 2e-60
Query Start/End: Original strand, 1 - 153
Target Start/End: Complemental strand, 34095355 - 34095206
Alignment:
| Q |
1 |
gaaaatgcaccatacttcaaaacctgttgttgttgatgaggaagatcaaagtgttttttcatcaatgccgctatcctctgcttctctaactgttcaactc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34095355 |
gaaaatgcaccatacttcaaaacctgttgttg---atgaggaagatcaaagtgttttttcatcaatgccgctatcctctgcttctctaactgttcaactc |
34095259 |
T |
 |
| Q |
101 |
ctacacctcttagtggnnnnnnnggtcctttaccattttttcttcctttgttt |
153 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
34095258 |
ctacacctcttagtggtttttttggtcctttaccattttttcttcctttgttt |
34095206 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University