View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0777_low_45 (Length: 209)
Name: NF0777_low_45
Description: NF0777
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0777_low_45 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 70; Significance: 9e-32; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 70; E-Value: 9e-32
Query Start/End: Original strand, 1 - 74
Target Start/End: Original strand, 44897393 - 44897466
Alignment:
Q |
1 |
ctcaggagttgactcgtttaacttctttttcaaaacaagttggagttgaaaaggtgaagcatgctaggactgat |
74 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
T |
44897393 |
ctcaggagttgactcgtttaacttctttttcaaaacaagttggagttgaaaaagtgaagcatgctaggactgat |
44897466 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 112 times since January 2019
Visitors: 5777