View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0778_high_34 (Length: 334)
Name: NF0778_high_34
Description: NF0778
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0778_high_34 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 198; Significance: 1e-108; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 73 - 290
Target Start/End: Complemental strand, 46534891 - 46534674
Alignment:
| Q |
73 |
agtgagatgaactggttataaattgcagggaatgttcaggagaatgataacaatatgtctctagacattcttaggaaagttgtttctgaaattgagacag |
172 |
Q |
| |
|
|||| ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
46534891 |
agtgtgatgaactggttataaattgcagggcatgttcaggagaatgataacaatatgtctctagacattcctaggaaagttgtttctgaaattgagacag |
46534792 |
T |
|
| Q |
173 |
ggtttattgagtttgcccgaagacattacgtgcaacatggtcaaccaaagattggtatagttagttcaggttgtctgatttgtatcatagagagaaggac |
272 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46534791 |
ggtttattgagtttgcccgaagacattacgtgcaacttggtcaaccaaagattggtatagttagttcaggttgtctgatttgtatcatagagagaaggac |
46534692 |
T |
|
| Q |
273 |
attatatctcaccaacgt |
290 |
Q |
| |
|
|||||||||| ||||||| |
|
|
| T |
46534691 |
attatatctcgccaacgt |
46534674 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 2 times since January 2019
Visitors: 5846