View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0778_high_37 (Length: 324)

Name: NF0778_high_37
Description: NF0778
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0778_high_37
NF0778_high_37
[»] chr1 (1 HSPs)
chr1 (9-109)||(48518386-48518486)


Alignment Details
Target: chr1 (Bit Score: 89; Significance: 7e-43; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 89; E-Value: 7e-43
Query Start/End: Original strand, 9 - 109
Target Start/End: Original strand, 48518386 - 48518486
Alignment:
9 atcataggcaaggatgggttctactaagttctaggtggagaaattcaagaacaataatgattccagtctttggagaatgaagatgaggactttcttggtt 108  Q
    |||| ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||    
48518386 atcaaaggcaaggacgggttctactaagttctaggtggagaaattcaagaacaataatgattccagtctttggagaatgaagatgaggattttcttggtt 48518485  T
109 a 109  Q
    |    
48518486 a 48518486  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 309 times since January 2019
Visitors: 5834