View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0778_high_55 (Length: 265)
Name: NF0778_high_55
Description: NF0778
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0778_high_55 |
 | |
|
| [»] scaffold0160 (1 HSPs) |
| |
|
Alignment Details
Target: scaffold0160 (Bit Score: 200; Significance: 1e-109; HSPs: 1)
Name: scaffold0160
Description:
Target: scaffold0160; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 42 - 265
Target Start/End: Complemental strand, 22603 - 22380
Alignment:
| Q |
42 |
taaatagtgttagataaacatcaataactaatatctcatataggtataactaactttaattttttaatttgagtcaaaagttttgaaacctagaacccta |
141 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22603 |
taaatagtgttagataaacatcaataactaatatctcatataggtataactaactttaattttttaatttgagtcaaaagttttgaaacctagaacccta |
22504 |
T |
|
| Q |
142 |
gattgggttgcttgtcccttagaccgactttgatattaacaatttataccaatcaactcttaaaatatctatttgaatttgtttggtggtgttgtcttgt |
241 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||| |||||||||||||||||||||||| ||||||||||||||||||| ||||| |
|
|
| T |
22503 |
gattgggttgcttgtcccttagactgactttgatattaacaatttatacgaatcaactcttaaaatatctatttaaatttgtttggtggtgttgccttgt |
22404 |
T |
|
| Q |
242 |
gatctagtagtgtgctcctctaga |
265 |
Q |
| |
|
||| ||||||| |||||||||||| |
|
|
| T |
22403 |
gatatagtagtctgctcctctaga |
22380 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 127 times since January 2019
Visitors: 5849