View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0778_high_69 (Length: 224)
Name: NF0778_high_69
Description: NF0778
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0778_high_69 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 170; Significance: 2e-91; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 170; E-Value: 2e-91
Query Start/End: Original strand, 1 - 174
Target Start/End: Original strand, 41132327 - 41132500
Alignment:
| Q |
1 |
tgtttatgtgagcaacatagaagcccttttctgatccactaatcgtgtgaagaagggtagttatgctttcgttgaggaatgatgaggagtgcttcaatcc |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
41132327 |
tgtttatgtgagcaacatagaagcccttttctgatccactaatcgtgtgaagaagggtagttatgctttcgttaaggaatgatgaggagtgcttcaatcc |
41132426 |
T |
|
| Q |
101 |
accctgtttctttgtagctaggcttcgcaaattcaaatatacctgcatgaaaaatgtgttatagattaaaatgt |
174 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41132427 |
accctgtttctttgtagctaggcttcgcaaattcaaatatacctgcatgaaaaatgtgttatagattaaaatgt |
41132500 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 34 times since January 2019
Visitors: 5846