View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0778_high_70 (Length: 224)
Name: NF0778_high_70
Description: NF0778
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0778_high_70 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 195; Significance: 1e-106; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 1 - 199
Target Start/End: Complemental strand, 41132351 - 41132153
Alignment:
Q |
1 |
ggcttctatgttgctcacataaacagctatcttggtgatgatccattcttgagtcaatatcttcctttggatccagctacaaatgatctatttgatcttt |
100 |
Q |
|
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
41132351 |
ggcttctatgttgctcacataaacagctaccttggtgatgatccattcttgagtcaatatcttcctttggatccagctacaaatgatctatttgatcttt |
41132252 |
T |
 |
Q |
101 |
caaaagatggcattcttctgtggtatataaccagggtctgctgatttttcgcattttacttctgtctgtactagcctttaatataataccgggtttgat |
199 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
41132251 |
caaaagatggcattcttctgtggtatataaccagggtctgctgatttttcgcattttacttctgtctgtactagcctttaatataataccgggtttgat |
41132153 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 70 times since January 2019
Visitors: 5847