View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0778_high_72 (Length: 218)
Name: NF0778_high_72
Description: NF0778
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0778_high_72 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 182; Significance: 1e-98; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 182; E-Value: 1e-98
Query Start/End: Original strand, 15 - 200
Target Start/End: Complemental strand, 14208891 - 14208706
Alignment:
Q |
15 |
catagggtagctgatttcttacttccaaacacatcagtaagtactcatttacgtaccaacttgtaacactggaaaaacattatctacgttaaagaacttt |
114 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
T |
14208891 |
catagggtagctgatttcttacttccaaacacatcagtaagtactcatttacgtaccaacttgtaacactggaaaaacattatctaagttaaagaacttt |
14208792 |
T |
 |
Q |
115 |
agtaaattactcataattagcatgattcatcaaatccttgagccatattgcaactttagtataaacagtaattaaattgcagtaag |
200 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
14208791 |
agtaaattactcataattagcatgattcatcaaatccttgagccatattgcaactttagtataaacagtaattaaattgcagtaag |
14208706 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 521 times since January 2019
Visitors: 5839