View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0778_high_76 (Length: 205)
Name: NF0778_high_76
Description: NF0778
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0778_high_76 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 144; Significance: 6e-76; HSPs: 4)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 144; E-Value: 6e-76
Query Start/End: Original strand, 1 - 144
Target Start/End: Complemental strand, 47419478 - 47419335
Alignment:
| Q |
1 |
gaaagggattgtgggggatcagatgcttaggatagcattagcaaaagtgcaacaacaggtaggtagaatagatgttttttcttaaggtggttagagatag |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47419478 |
gaaagggattgtgggggatcagatgcttaggatagcattagcaaaagtgcaacaacaggtaggtagaatagatgttttttcttaaggtggttagagatag |
47419379 |
T |
|
| Q |
101 |
gtttcaacgttatgctaagaaccgtcctttttcttgtagacaaa |
144 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47419378 |
gtttcaacgttatgctaagaaccgtcctttttcttgtagacaaa |
47419335 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 112; E-Value: 8e-57
Query Start/End: Original strand, 1 - 144
Target Start/End: Complemental strand, 47391115 - 47390972
Alignment:
| Q |
1 |
gaaagggattgtgggggatcagatgcttaggatagcattagcaaaagtgcaacaacaggtaggtagaatagatgttttttcttaaggtggttagagatag |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |||||||||| |||||| |||||||||||||||||| |
|
|
| T |
47391115 |
gaaagggattgtgggggatcagatgcttaggatagcattaacaaaagtgcaacaacaggtaggcagaatagatgatttttcctaaggtggttagagatag |
47391016 |
T |
|
| Q |
101 |
gtttcaacgttatgctaagaaccgtcctttttcttgtagacaaa |
144 |
Q |
| |
|
|||||||||||||||||||||| |||||||| ||| ||||||| |
|
|
| T |
47391015 |
atttcaacgttatgctaagaaccatcctttttattgcagacaaa |
47390972 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 70; E-Value: 9e-32
Query Start/End: Original strand, 1 - 135
Target Start/End: Complemental strand, 47421950 - 47421796
Alignment:
| Q |
1 |
gaaagggattgtgggggatcagatgcttaggatagcattagcaaaagtgcaacaacaggtaggtagaatag--------------------atgtttttt |
80 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |||| |||| |
|
|
| T |
47421950 |
gaaagggattgtgggggatccgatgcttaggatagcattagcaaaagtgcaacaacaggtaggtagaatagatagtttactttatcttacaatgtgtttt |
47421851 |
T |
|
| Q |
81 |
cttaaggtggttagagataggtttcaacgttatgctaagaaccgtcctttttctt |
135 |
Q |
| |
|
||||||||||||| |||||| |||||||||||||||||||||| ||||||||||| |
|
|
| T |
47421850 |
cttaaggtggttaaagatagatttcaacgttatgctaagaaccatcctttttctt |
47421796 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 1 - 67
Target Start/End: Complemental strand, 47408249 - 47408183
Alignment:
| Q |
1 |
gaaagggattgtgggggatcagatgcttaggatagcattagcaaaagtgcaacaacaggtaggtaga |
67 |
Q |
| |
|
|||||||||||||| |||||||||| |||||| ||||||| || ||||||| ||||||||||||||| |
|
|
| T |
47408249 |
gaaagggattgtggaggatcagatgattaggaaagcattaacagaagtgcagcaacaggtaggtaga |
47408183 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 50; Significance: 8e-20; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 50; E-Value: 8e-20
Query Start/End: Original strand, 146 - 203
Target Start/End: Original strand, 35724810 - 35724867
Alignment:
| Q |
146 |
ccctagctgttgcctcacataggtgggatccacatcgtagaagacagggcaaacataa |
203 |
Q |
| |
|
|||| |||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35724810 |
cccttgctggtgcctcacataggtgggatccacatcgtagaagacagggcaaacataa |
35724867 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 273 times since January 2019
Visitors: 5834