View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0778_high_78 (Length: 202)
Name: NF0778_high_78
Description: NF0778
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0778_high_78 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 87; Significance: 7e-42; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 87; E-Value: 7e-42
Query Start/End: Original strand, 1 - 91
Target Start/End: Original strand, 39979360 - 39979450
Alignment:
Q |
1 |
atcacaatggcattagaaaatggcaaattcacaactttattggtttaatggcagagattacaatttactagaatgttctgtgctgctcctc |
91 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
T |
39979360 |
atcacaatggcattagaaaatggcaaattcacaactttattggtttaatggcagagattacaatttactagaatgttctgttctgctcctc |
39979450 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 476 times since January 2019
Visitors: 5838