View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0778_low_112 (Length: 253)
Name: NF0778_low_112
Description: NF0778
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0778_low_112 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 85; Significance: 1e-40; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 85; E-Value: 1e-40
Query Start/End: Original strand, 152 - 240
Target Start/End: Complemental strand, 31041048 - 31040960
Alignment:
Q |
152 |
ccaacaaaatcttgggcatcacttgcatggtaatgagactttaggtgccttataaagcttacacgaggattcaactacttttcactcct |
240 |
Q |
|
|
|||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
31041048 |
ccaacaaaatcttgggtatcacttgcatggtaatgagactttaggtgccttataaagcttacacgaggattcaactacttttcactcct |
31040960 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 1 - 55
Target Start/End: Complemental strand, 31041202 - 31041145
Alignment:
Q |
1 |
aatactattcgaatgcattacaactagcaaaccacgt---tagagtgtttgggattgg |
55 |
Q |
|
|
|||||||||||||||||||||||||||||||||| || ||||||||||||||||| |
|
|
T |
31041202 |
aatactattcgaatgcattacaactagcaaaccaggtagagagagtgtttgggattgg |
31041145 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 467 times since January 2019
Visitors: 5838