View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0778_low_113 (Length: 253)

Name: NF0778_low_113
Description: NF0778
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0778_low_113
NF0778_low_113
[»] chr2 (2 HSPs)
chr2 (152-242)||(31040958-31041048)
chr2 (1-55)||(31041145-31041202)


Alignment Details
Target: chr2 (Bit Score: 87; Significance: 8e-42; HSPs: 2)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 87; E-Value: 8e-42
Query Start/End: Original strand, 152 - 242
Target Start/End: Complemental strand, 31041048 - 31040958
Alignment:
152 ccaacaaaatcttgggcatcacttgcatggtaatgagactttaggtgccttataaagcttacacgaggattcaactacttttcactccttt 242  Q
    |||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
31041048 ccaacaaaatcttgggtatcacttgcatggtaatgagactttaggtgccttataaagcttacacgaggattcaactacttttcactccttt 31040958  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 1 - 55
Target Start/End: Complemental strand, 31041202 - 31041145
Alignment:
1 aatactattcgaatgcattacaactagcaaaccacgt---tagagtgtttgggattgg 55  Q
    |||||||||||||||||||||||||||||||||| ||    |||||||||||||||||    
31041202 aatactattcgaatgcattacaactagcaaaccaggtagagagagtgtttgggattgg 31041145  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University