View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0778_low_113 (Length: 253)
Name: NF0778_low_113
Description: NF0778
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0778_low_113 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 87; Significance: 8e-42; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 87; E-Value: 8e-42
Query Start/End: Original strand, 152 - 242
Target Start/End: Complemental strand, 31041048 - 31040958
Alignment:
| Q |
152 |
ccaacaaaatcttgggcatcacttgcatggtaatgagactttaggtgccttataaagcttacacgaggattcaactacttttcactccttt |
242 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31041048 |
ccaacaaaatcttgggtatcacttgcatggtaatgagactttaggtgccttataaagcttacacgaggattcaactacttttcactccttt |
31040958 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 1 - 55
Target Start/End: Complemental strand, 31041202 - 31041145
Alignment:
| Q |
1 |
aatactattcgaatgcattacaactagcaaaccacgt---tagagtgtttgggattgg |
55 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| || ||||||||||||||||| |
|
|
| T |
31041202 |
aatactattcgaatgcattacaactagcaaaccaggtagagagagtgtttgggattgg |
31041145 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 289 times since January 2019
Visitors: 5834