View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0778_low_116 (Length: 251)
Name: NF0778_low_116
Description: NF0778
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0778_low_116 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 179; Significance: 1e-96; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 179; E-Value: 1e-96
Query Start/End: Original strand, 1 - 203
Target Start/End: Complemental strand, 48518336 - 48518134
Alignment:
| Q |
1 |
aaacaaaacctgcaacttgattgcagtgacaaacatgaacaagaatataatggcaattatataaagaattgagagaacttagagagagtaaattgtagaa |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
48518336 |
aaacaaaacctgcaacttgattgcagtgacaaacatgaacaagaatatagtggcaattatataaagaattgagagactttagagagagtaaattgtagaa |
48518237 |
T |
|
| Q |
101 |
tggattatctttattatttccttgatgaacaattacaatccttatgcaggcctaacaattataactaattagtaacgtactaactaacttggttacattc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| ||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
48518236 |
tggattatctttattatttccttgatgaacaattacaatccttatgtaggcctaacaattatcactaactagtaacgtactaactaacttggttacattc |
48518137 |
T |
|
| Q |
201 |
tgt |
203 |
Q |
| |
|
||| |
|
|
| T |
48518136 |
tgt |
48518134 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 57 times since January 2019
Visitors: 5846