View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0778_low_116 (Length: 251)

Name: NF0778_low_116
Description: NF0778
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0778_low_116
NF0778_low_116
[»] chr1 (1 HSPs)
chr1 (1-203)||(48518134-48518336)


Alignment Details
Target: chr1 (Bit Score: 179; Significance: 1e-96; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 179; E-Value: 1e-96
Query Start/End: Original strand, 1 - 203
Target Start/End: Complemental strand, 48518336 - 48518134
Alignment:
1 aaacaaaacctgcaacttgattgcagtgacaaacatgaacaagaatataatggcaattatataaagaattgagagaacttagagagagtaaattgtagaa 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||  ||||||||||||||||||||||    
48518336 aaacaaaacctgcaacttgattgcagtgacaaacatgaacaagaatatagtggcaattatataaagaattgagagactttagagagagtaaattgtagaa 48518237  T
101 tggattatctttattatttccttgatgaacaattacaatccttatgcaggcctaacaattataactaattagtaacgtactaactaacttggttacattc 200  Q
    |||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| ||||| |||||||||||||||||||||||||||||||    
48518236 tggattatctttattatttccttgatgaacaattacaatccttatgtaggcctaacaattatcactaactagtaacgtactaactaacttggttacattc 48518137  T
201 tgt 203  Q
    |||    
48518136 tgt 48518134  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 57 times since January 2019
Visitors: 5846