View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0778_low_123 (Length: 228)
Name: NF0778_low_123
Description: NF0778
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0778_low_123 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 206; Significance: 1e-113; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 206; E-Value: 1e-113
Query Start/End: Original strand, 9 - 228
Target Start/End: Original strand, 30149252 - 30149468
Alignment:
| Q |
9 |
agtttgtcatggacttgagctgctttttgaacaatgtagtgatagcctgattctttttaacttcttctgcagattggggacctaacattgacattgttgg |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
30149252 |
agtttgtcatggacttgagctgctttttgaacaatgtagtgatagcctgattctttttaacttc---tgcagattggggacctaacattgacattgttgg |
30149348 |
T |
 |
| Q |
109 |
cttttgtttcctcgaccttgcttcaaattatgaaccaccaaaatcgctagtagattggcttgaagaaggagaaaaccctatctatgttggatttggtagt |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30149349 |
cttttgtttcctcgaccttgcttcaaattatgaaccaccaaaatcgctagtagattggcttgaagaaggagaaaaccctatctatgttggatttggtagt |
30149448 |
T |
 |
| Q |
209 |
ctcgtgagtttctataacta |
228 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
30149449 |
ctcgtgagtttctataacta |
30149468 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University