View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0778_low_127 (Length: 222)

Name: NF0778_low_127
Description: NF0778
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0778_low_127
NF0778_low_127
[»] chr1 (1 HSPs)
chr1 (92-122)||(25180188-25180218)
[»] chr8 (1 HSPs)
chr8 (144-173)||(9609677-9609706)


Alignment Details
Target: chr1 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 92 - 122
Target Start/End: Complemental strand, 25180218 - 25180188
Alignment:
92 cggaaaataacccaaacaaaaaactcagcat 122  Q
    |||||||||||||||||||||||||||||||    
25180218 cggaaaataacccaaacaaaaaactcagcat 25180188  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 30; Significance: 0.00000007; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 144 - 173
Target Start/End: Complemental strand, 9609706 - 9609677
Alignment:
144 gtgttctattctatgttaggttttccaaat 173  Q
    ||||||||||||||||||||||||||||||    
9609706 gtgttctattctatgttaggttttccaaat 9609677  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University