View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0778_low_127 (Length: 222)
Name: NF0778_low_127
Description: NF0778
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0778_low_127 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 92 - 122
Target Start/End: Complemental strand, 25180218 - 25180188
Alignment:
| Q |
92 |
cggaaaataacccaaacaaaaaactcagcat |
122 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
25180218 |
cggaaaataacccaaacaaaaaactcagcat |
25180188 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 30; Significance: 0.00000007; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 144 - 173
Target Start/End: Complemental strand, 9609706 - 9609677
Alignment:
| Q |
144 |
gtgttctattctatgttaggttttccaaat |
173 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
9609706 |
gtgttctattctatgttaggttttccaaat |
9609677 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University