View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0778_low_128 (Length: 222)

Name: NF0778_low_128
Description: NF0778
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0778_low_128
NF0778_low_128
[»] chr8 (1 HSPs)
chr8 (141-194)||(10098440-10098492)


Alignment Details
Target: chr8 (Bit Score: 42; Significance: 0.000000000000005; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 141 - 194
Target Start/End: Original strand, 10098440 - 10098492
Alignment:
141 agtgagatgaaagcaacattaggtttttattattgtttggcattgagtgtttaa 194  Q
    ||||| |||||||||||||||| |||||||||||||||||||||||||||||||    
10098440 agtgatatgaaagcaacattag-tttttattattgtttggcattgagtgtttaa 10098492  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University