View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0778_low_132 (Length: 218)
Name: NF0778_low_132
Description: NF0778
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0778_low_132 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 140; Significance: 2e-73; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 140; E-Value: 2e-73
Query Start/End: Original strand, 1 - 152
Target Start/End: Original strand, 26197495 - 26197646
Alignment:
| Q |
1 |
cgacgaatactcacggaacgcgccggcttgaagctgtttgatctcttgatgttcttggagaatatgtttgatgaatttgaaaggataaggtacaccaaag |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26197495 |
cgacgaatactcacggaacgcgccggcttgaagctgtttgatctcttgatgttcttggagaatatgtttgatgaatttgaaaggataaggtacaccaaag |
26197594 |
T |
|
| Q |
101 |
cttggactaggatgaacatagccaccttcaataacatgtcacctatgctact |
152 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||| |||| |||||| |
|
|
| T |
26197595 |
cttggactaggacgaacatagccaccttcaataacatgtctcctaagctact |
26197646 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 475 times since January 2019
Visitors: 5838