View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0778_low_134 (Length: 215)
Name: NF0778_low_134
Description: NF0778
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0778_low_134 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 206; Significance: 1e-113; HSPs: 3)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 206; E-Value: 1e-113
Query Start/End: Original strand, 1 - 206
Target Start/End: Complemental strand, 37111432 - 37111227
Alignment:
Q |
1 |
tgttgatgctcctttctctgttgcttttagtgctgttggaatggattgggctaagtacattgtttcattaggcgctttaaaaggaatgacaacggttttg |
100 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
37111432 |
tgttgatgctcctttctctgttgcttttagtgctgttggaatggattgggctaagtacattgtttcattaggcgctttaaaaggaatgacaacggttttg |
37111333 |
T |
 |
Q |
101 |
ttggttggtgctgttggtcaagctcgttatttaactcacattgcacgtactcacatgatgccgccttggtttgctcatgttgatgaaagaacaggaacac |
200 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
37111332 |
ttggttggtgctgttggtcaagctcgttatttaactcacattgcacgtactcacatgatgccgccttggtttgctcatgttgatgaaagaacaggaacac |
37111233 |
T |
 |
Q |
201 |
ctatga |
206 |
Q |
|
|
|||||| |
|
|
T |
37111232 |
ctatga |
37111227 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 167; E-Value: 1e-89
Query Start/End: Original strand, 4 - 206
Target Start/End: Complemental strand, 37119684 - 37119482
Alignment:
Q |
4 |
tgatgctcctttctctgttgcttttagtgctgttggaatggattgggctaagtacattgtttcattaggcgctttaaaaggaatgacaacggttttgttg |
103 |
Q |
|
|
||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||||||||||||||| |
|
|
T |
37119684 |
tgatgctcctttctcagttgcttttagtgctgttggaatggattgggctaagtacattgtttcattaggtgctttgaaaggaatgacaacggttttgttg |
37119585 |
T |
 |
Q |
104 |
gttggtgctgttggtcaagctcgttatttaactcacattgcacgtactcacatgatgccgccttggtttgctcatgttgatgaaagaacaggaacaccta |
203 |
Q |
|
|
||| |||| ||||||||||||||||| ||||| |||||||||||||||||||||||||| ||||||||||||| |||||||||||||||||||||||||| |
|
|
T |
37119584 |
gttagtgcggttggtcaagctcgttacttaacacacattgcacgtactcacatgatgccaccttggtttgctcttgttgatgaaagaacaggaacaccta |
37119485 |
T |
 |
Q |
204 |
tga |
206 |
Q |
|
|
||| |
|
|
T |
37119484 |
tga |
37119482 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 55; E-Value: 9e-23
Query Start/End: Original strand, 20 - 186
Target Start/End: Original strand, 37136585 - 37136751
Alignment:
Q |
20 |
gttgcttttagtgctgttggaatggattgggctaagtacattgtttcattaggcgctttaaaaggaatgacaacggttttgttggttggtgctgttggtc |
119 |
Q |
|
|
||||| |||||| |||||||| || |||||||| ||||||||| |||| || || || || |||||||| || |||||||||||| || ||| ||| |
|
|
T |
37136585 |
gttgcatttagttctgttggatggggatgggctaaatacattgttgcattgggagcattgaagggaatgacgactgttttgttggttaatgttgtcggtg |
37136684 |
T |
 |
Q |
120 |
aagctcgttatttaactcacattgcacgtactcacatgatgccgccttggtttgctcatgttgatga |
186 |
Q |
|
|
| |||||||||||||||||||| ||||||||||||||||| ||||||||||||| |||| |||| |
|
|
T |
37136685 |
cctcacgttatttaactcacattgctcgtactcacatgatgcctccttggtttgctcttgttcatga |
37136751 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 36; Significance: 0.00000000002; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 32 - 123
Target Start/End: Original strand, 10681104 - 10681195
Alignment:
Q |
32 |
gctgttggaatggattgggctaagtacattgtttcattaggcgctttaaaaggaatgacaacggttttgttggttggtgctgttggtcaagc |
123 |
Q |
|
|
|||||||||||| | ||||||||||| |||||| |||| || || || ||||||||||| | ||||| | |||||||||||||||||||| |
|
|
T |
10681104 |
gctgttggaatgaaatgggctaagtatattgttgcatttggtgcattgaaaggaatgactagtgttttacttgttggtgctgttggtcaagc |
10681195 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 318 times since January 2019
Visitors: 5835