View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0778_low_135 (Length: 214)
Name: NF0778_low_135
Description: NF0778
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0778_low_135 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 122; Significance: 9e-63; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 122; E-Value: 9e-63
Query Start/End: Original strand, 2 - 135
Target Start/End: Original strand, 32429889 - 32430022
Alignment:
Q |
2 |
agtaattgttccttattgtggaaagtttgtcatggtaagctccttactaatgaagaaagaaatggcctctaatagtatttgtatgtgttgcaattatcgt |
101 |
Q |
|
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
T |
32429889 |
agtaattgttccttattttggaaagtttgtcatggtaagctccttactaatgaagaaagaaacggcctctaatagtatttgtatgtgttgcaattatcgt |
32429988 |
T |
 |
Q |
102 |
gatgactttattatgtgtgttattcgtgtctgtg |
135 |
Q |
|
|
|||||||||||||||||||||||||||| ||||| |
|
|
T |
32429989 |
gatgactttattatgtgtgttattcgtgactgtg |
32430022 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University