View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0778_low_137 (Length: 213)
Name: NF0778_low_137
Description: NF0778
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0778_low_137 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 75; Significance: 1e-34; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 75; E-Value: 1e-34
Query Start/End: Original strand, 43 - 138
Target Start/End: Original strand, 36900001 - 36900096
Alignment:
Q |
43 |
gtcaccaatcgaggaagtccggttaacggtgnnnnnnnccgacgacccaacacttccagtatggaccttccgcatgtggtttctaggtcttctctc |
138 |
Q |
|
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
36900001 |
gtcaccaatcgaggaagtccggttaacggtgaaaaaaaccgacgacccaacacttccagtatggaccttccgcatgtggtttctaggtcttctctc |
36900096 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University