View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0778_low_139 (Length: 212)
Name: NF0778_low_139
Description: NF0778
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0778_low_139 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 111; Significance: 3e-56; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 111; E-Value: 3e-56
Query Start/End: Original strand, 1 - 139
Target Start/End: Complemental strand, 9713968 - 9713830
Alignment:
Q |
1 |
catcgacgatactatattagaaataaatgagctatttacatattagtacggttaatttcacgacccttatatttacagttaatttggtgacttatagata |
100 |
Q |
|
|
|||||||||||||| |||||||||||||||| ||| ||||||| |||||||||||||| |||||||||||||||| ||||||||||||||||||||||| |
|
|
T |
9713968 |
catcgacgatactacattagaaataaatgagttatctacatatcagtacggttaattttacgacccttatatttatagttaatttggtgacttatagatg |
9713869 |
T |
 |
Q |
101 |
tcggttcaatacgaactacatatttattttcctttgttt |
139 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||| |
|
|
T |
9713868 |
tcggttcaatacgaactacatatttattttcctttgttt |
9713830 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 85 - 139
Target Start/End: Complemental strand, 16952611 - 16952556
Alignment:
Q |
85 |
tggtgactt-atagatatcggttcaatacgaactacatatttattttcctttgttt |
139 |
Q |
|
|
||||||||| || ||||||||||||||| || ||||||||||||||||| |||||| |
|
|
T |
16952611 |
tggtgacttgattgatatcggttcaataggagctacatatttattttccgttgttt |
16952556 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University