View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0778_low_140 (Length: 212)
Name: NF0778_low_140
Description: NF0778
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0778_low_140 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 122; Significance: 9e-63; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 122; E-Value: 9e-63
Query Start/End: Original strand, 1 - 126
Target Start/End: Original strand, 14208766 - 14208891
Alignment:
Q |
1 |
atcatgctaattatgagtaatttactaaagttctttaacgtagataatgtttttccagtgttacaagttggtacgtaaatgagtacttactgatgtgttt |
100 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
14208766 |
atcatgctaattatgagtaatttactaaagttctttaacttagataatgtttttccagtgttacaagttggtacgtaaatgagtacttactgatgtgttt |
14208865 |
T |
 |
Q |
101 |
ggaagtaagaaatcagctaccctatg |
126 |
Q |
|
|
|||||||||||||||||||||||||| |
|
|
T |
14208866 |
ggaagtaagaaatcagctaccctatg |
14208891 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University