View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0778_low_140 (Length: 212)

Name: NF0778_low_140
Description: NF0778
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0778_low_140
NF0778_low_140
[»] chr2 (1 HSPs)
chr2 (1-126)||(14208766-14208891)


Alignment Details
Target: chr2 (Bit Score: 122; Significance: 9e-63; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 122; E-Value: 9e-63
Query Start/End: Original strand, 1 - 126
Target Start/End: Original strand, 14208766 - 14208891
Alignment:
1 atcatgctaattatgagtaatttactaaagttctttaacgtagataatgtttttccagtgttacaagttggtacgtaaatgagtacttactgatgtgttt 100  Q
    ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
14208766 atcatgctaattatgagtaatttactaaagttctttaacttagataatgtttttccagtgttacaagttggtacgtaaatgagtacttactgatgtgttt 14208865  T
101 ggaagtaagaaatcagctaccctatg 126  Q
    ||||||||||||||||||||||||||    
14208866 ggaagtaagaaatcagctaccctatg 14208891  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University