View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0778_low_143 (Length: 210)
Name: NF0778_low_143
Description: NF0778
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0778_low_143 |
 |  |
|
[»] chr1 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 153; Significance: 3e-81; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 153; E-Value: 3e-81
Query Start/End: Original strand, 58 - 210
Target Start/End: Complemental strand, 46933406 - 46933254
Alignment:
Q |
58 |
cacagattgtggaatggttctattagacaagaactggtcattggtcagaagcacctcctttgccatgttggctgaggagacgacgacagtggttattcgg |
157 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
46933406 |
cacagattgtggaatggttctattagacaagaactggtcattggtcagaagcacctcctttgccatgttggctgaggagacgacgacagtggttattcgg |
46933307 |
T |
 |
Q |
158 |
ccaaacttgagacttattatagaaccatgaatctttgtaagattggctaagga |
210 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
46933306 |
ccaaacttgagacttattatagaaccatgaatctttgtaagattggctaagga |
46933254 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 58 - 189
Target Start/End: Complemental strand, 46926541 - 46926410
Alignment:
Q |
58 |
cacagattgtggaatggttctattagacaagaactggtcattggtcagaagcacctcctttgccatgttggctgaggagacgacgacagtggttattcgg |
157 |
Q |
|
|
||||| ||| || ||| |||| || |||||||||| ||||||||| || || ||||| || ||||| | |||||||||| || | |||||||||| || |
|
|
T |
46926541 |
cacagtttgaggtatgtttctctttgacaagaacttgtcattggttaggagaacctctttagccattgttgctgaggagataacaatagtggttatttgg |
46926442 |
T |
 |
Q |
158 |
ccaaacttgagacttattatagaaccatgaat |
189 |
Q |
|
|
|||||||||||||| |||| || |||||||| |
|
|
T |
46926441 |
ccaaacttgagactcattaaagggccatgaat |
46926410 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University