View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0778_low_144 (Length: 209)
Name: NF0778_low_144
Description: NF0778
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0778_low_144 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 120; Significance: 1e-61; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 120; E-Value: 1e-61
Query Start/End: Original strand, 1 - 124
Target Start/End: Original strand, 3982894 - 3983017
Alignment:
Q |
1 |
ccaaaatattcgacgctccggttatttactcttttgataattatgtctgattgctataaccaggtttctatttcgtagtaaccggccactattagttctg |
100 |
Q |
|
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
3982894 |
ccaaaatattcgacactccggttatttactcttttgataattatgtctgattgctataaccaggtttctatttcgtagtaaccggccactattagttctg |
3982993 |
T |
 |
Q |
101 |
tgtagtacgttcttgtgttttctc |
124 |
Q |
|
|
|||||||||||||||||||||||| |
|
|
T |
3982994 |
tgtagtacgttcttgtgttttctc |
3983017 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University