View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0778_low_144 (Length: 209)

Name: NF0778_low_144
Description: NF0778
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0778_low_144
NF0778_low_144
[»] chr5 (1 HSPs)
chr5 (1-124)||(3982894-3983017)


Alignment Details
Target: chr5 (Bit Score: 120; Significance: 1e-61; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 120; E-Value: 1e-61
Query Start/End: Original strand, 1 - 124
Target Start/End: Original strand, 3982894 - 3983017
Alignment:
1 ccaaaatattcgacgctccggttatttactcttttgataattatgtctgattgctataaccaggtttctatttcgtagtaaccggccactattagttctg 100  Q
    |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
3982894 ccaaaatattcgacactccggttatttactcttttgataattatgtctgattgctataaccaggtttctatttcgtagtaaccggccactattagttctg 3982993  T
101 tgtagtacgttcttgtgttttctc 124  Q
    ||||||||||||||||||||||||    
3982994 tgtagtacgttcttgtgttttctc 3983017  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University