View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0778_low_145 (Length: 209)

Name: NF0778_low_145
Description: NF0778
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0778_low_145
NF0778_low_145
[»] chr4 (1 HSPs)
chr4 (1-141)||(6346467-6346607)


Alignment Details
Target: chr4 (Bit Score: 137; Significance: 1e-71; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 137; E-Value: 1e-71
Query Start/End: Original strand, 1 - 141
Target Start/End: Original strand, 6346467 - 6346607
Alignment:
1 acttgcttgtctttgctgtcactgtgtcaccatagttattattttgtacttctgtattgtctccagaatttacttcctcaaggtccactgtgactataca 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||    
6346467 acttgcttgtctttgctgtcactgtgtcaccatagttattattttgtacttctgtattgtctccagaatttacttcctcaaggtccactgtgactattca 6346566  T
101 tggtttgagctattaggtttttcaaataatgggggaagaat 141  Q
    |||||||||||||||||||||||||||||||||||||||||    
6346567 tggtttgagctattaggtttttcaaataatgggggaagaat 6346607  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 474 times since January 2019
Visitors: 5838