View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0778_low_150 (Length: 202)
Name: NF0778_low_150
Description: NF0778
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0778_low_150 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 100; Significance: 1e-49; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 100; E-Value: 1e-49
Query Start/End: Original strand, 3 - 114
Target Start/End: Original strand, 39298724 - 39298835
Alignment:
| Q |
3 |
tcacgccatgattcatctttcttcttagcagtaaactccttagcagtctcgccagcagaagcagccaaacctttcacaacatccaccgatttcgacgcaa |
102 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
39298724 |
tcacgccatgattcatctttcttcttagcagtaaactccttagcagtctcaccagcagaagcagccaaacctttcacaacatccaccgatttcaacgcaa |
39298823 |
T |
|
| Q |
103 |
gctcggccgcct |
114 |
Q |
| |
|
|| ||||||||| |
|
|
| T |
39298824 |
gcccggccgcct |
39298835 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 473 times since January 2019
Visitors: 5838