View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0778_low_152 (Length: 202)
Name: NF0778_low_152
Description: NF0778
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0778_low_152 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 84; Significance: 4e-40; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 84; E-Value: 4e-40
Query Start/End: Original strand, 5 - 96
Target Start/End: Original strand, 33262110 - 33262201
Alignment:
| Q |
5 |
aactgccatattggaggggtcaacaatgactagtttgcaaccgcagaatgccacattgcaagggccagcaagtctgcctttcaacatcccaa |
96 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |||||||||||||||||||||||| |
|
|
| T |
33262110 |
aactgccatattggaggggtcaacaatgactagtttgcaaccgcagaatgccacactgcaagggccaacaagtctgcctttcaacatcccaa |
33262201 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 158 times since January 2019
Visitors: 5832