View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0778_low_18 (Length: 503)
Name: NF0778_low_18
Description: NF0778
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0778_low_18 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 365; Significance: 0; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 365; E-Value: 0
Query Start/End: Original strand, 97 - 492
Target Start/End: Original strand, 46721503 - 46721901
Alignment:
| Q |
97 |
catcatcacttttcgcttcatcaaacatct---gtacgtggtctgggatagggggctcttgctcaacttttctgacagtttttggtaacgacgagacaaa |
193 |
Q |
| |
|
||||||||||||| |||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46721503 |
catcatcactttttgcttcatcaaacatcttctgtacgtggtctgggatagggggctcttgctcaacttttctgacagtttttggtaacgacgagacaaa |
46721602 |
T |
|
| Q |
194 |
ctgagaaattttttcagctatctcaactgcgacatcctcctatgaaacagcaaacagaaaattttatcaatatcactaaataaaatgtcattttatgtga |
293 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46721603 |
ctgagaaattttttcagctatctcaactgcgacatcctcctaagaaacagcaaacagaaaattttatcaatatcactaaataaaatgtcattttatgtga |
46721702 |
T |
|
| Q |
294 |
tatataagcacaaataaatgattcggatccaccaggagtaggcgaatggccgaataggatatggaaaaatatcaggaggctcacgagcaagatttcttgg |
393 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
46721703 |
tatataaacacaaataaatgattcggatccaccaggagtaggcgaatggccgaataggaaatggaagaatatcaggaggctcacgagcaagatttcttgg |
46721802 |
T |
|
| Q |
394 |
cttcagtggtaaaaatcttttaagtaaccaacaatcaaagttaattagcataacgacatagttctttctgtacctcaaatatcataattgaacatctct |
492 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46721803 |
cttcagtggtaaaaatcttttaagtaaccaacaatcaaagttaattagcataacgacatagttctttctgtacctcaaatatcataattgaacatctct |
46721901 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 9 times since January 2019
Visitors: 5846