View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0778_low_27 (Length: 435)
Name: NF0778_low_27
Description: NF0778
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0778_low_27 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 225; Significance: 1e-124; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 225; E-Value: 1e-124
Query Start/End: Original strand, 98 - 361
Target Start/End: Complemental strand, 13298841 - 13298577
Alignment:
| Q |
98 |
agagagaaggataggcgccatgagattgaccgattttgtaaattgagagacgctaatgactgtgaaaagttgtttgtttatttatttcaataatttaaca |
197 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
13298841 |
agagagaaggataggcgccatgagattgaccgattttgtaaattgagagacgctaatgactgtgaaaaattgtttgtttatttatttcaataatttaaca |
13298742 |
T |
|
| Q |
198 |
gtccatgtatatatgtgaaaattgtatggatactgaacctattttgttgcacctcgatgaactagtcttcgtgaaccaacctttctatctttttcttgct |
297 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
13298741 |
gtccatttatatatgtgaaaattgtatggatactgaacttattttgttgcacctcgatgaactagtcttcttgaaccaacctttctatctttttcttgct |
13298642 |
T |
|
| Q |
298 |
tttagaggcaaggg-tcgtcctcgtggtcatcattatcaagaaatttcgacttcaggcgggcatc |
361 |
Q |
| |
|
|||||||||||||| |||| ||| ||||||||||||||||||||||| | ||||||||||||||| |
|
|
| T |
13298641 |
tttagaggcaagggctcgtactcatggtcatcattatcaagaaattttggcttcaggcgggcatc |
13298577 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 450 times since January 2019
Visitors: 5836