View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0778_low_28 (Length: 430)
Name: NF0778_low_28
Description: NF0778
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0778_low_28 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 243; Significance: 1e-134; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 243; E-Value: 1e-134
Query Start/End: Original strand, 91 - 333
Target Start/End: Original strand, 52579193 - 52579435
Alignment:
| Q |
91 |
cattgagttgttgtggagaagaagaacgtccacgtccttggatgccaacaagagcttggatgagtgagttttcagattcttcggtaactattgaaatttg |
190 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52579193 |
cattgagttgttgtggagaagaagaacgtccacgtccttggatgccaacaagagcttggatgagtgagttttcagattcttcggtaactattgaaatttg |
52579292 |
T |
|
| Q |
191 |
ctcaactttagaacacccagcagacacaaagcgagaatttgagggattgggagaaataaaagttgaacaacgtgaacatgactcaaatcctatactgttt |
290 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52579293 |
ctcaactttagaacacccagcagacacaaagcgagaatttgagggattgggagaaataaaagttgaacaacgtgaacatgactcaaatcctatactgttt |
52579392 |
T |
|
| Q |
291 |
acattcacaactctgagagtgagagccattgttacagacagac |
333 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52579393 |
acattcacaactctgagagtgagagccattgttacagacagac |
52579435 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 75; E-Value: 2e-34
Query Start/End: Original strand, 346 - 420
Target Start/End: Original strand, 52579472 - 52579546
Alignment:
| Q |
346 |
ttctctgtttttctgttatgttatgtgtggctggcgccaagattatgtctgtcccactcttgccaatcattcatc |
420 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52579472 |
ttctctgtttttctgttatgttatgtgtggctggcgccaagattatgtctgtcccactcttgccaatcattcatc |
52579546 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 29 - 67
Target Start/End: Original strand, 52579135 - 52579173
Alignment:
| Q |
29 |
aggaacatatatattgatataaaattatgaaagtaagaa |
67 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52579135 |
aggaacatatatattgatataaaattatgaaagtaagaa |
52579173 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 524 times since January 2019
Visitors: 5839