View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0778_low_32 (Length: 421)
Name: NF0778_low_32
Description: NF0778
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0778_low_32 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 245; Significance: 1e-136; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 245; E-Value: 1e-136
Query Start/End: Original strand, 12 - 292
Target Start/End: Original strand, 7595443 - 7595717
Alignment:
| Q |
12 |
gaatatgtattggacttctagaatcaagacaacattggacttcatgtaggtaatggaagtacatttgcagtacttaggtacatcatattactaacatatt |
111 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
7595443 |
gaatatgtattggacttctagaattaagacaacattggacttcatgtaggtaatggaagtacatt-gcagtacttaggtacatcatattactaacatatt |
7595541 |
T |
|
| Q |
112 |
gccaactcctcttctcattgaagatagtgcaactaactagaaagagcagataagttttgatacatcatattattctattctatgacaatctttaacgaac |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
7595542 |
gccaactcctcttctcattgaagatagtgcaactaactagaaagagcaaataagttttgatacatcatat-----tattctatgacaatctttaacgaac |
7595636 |
T |
|
| Q |
212 |
ttcatcccttgttatttctcaaactcaatgtctttgttcagattatggtggaaaatttcttcaatccatttttatgtctac |
292 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7595637 |
ttcatcccttgttatttctcaaactcaatgtctttgttcagattatggtggaaaatttcttcaatccatttttatgtctac |
7595717 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 88; E-Value: 4e-42
Query Start/End: Original strand, 293 - 392
Target Start/End: Original strand, 7596535 - 7596634
Alignment:
| Q |
293 |
tctacaccgaggaactcattcatcgattcactaacttcatgactttatctttaggccttcgtggaagatggttaaacaatttatcgttgataggcaagtg |
392 |
Q |
| |
|
|||||||||||||||| ||||||| ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
7596535 |
tctacaccgaggaacttattcatcaattcactaacttcatgactttatctttaggccttcgtggaaaatggttaaacaatttatcgttgataggcaagtg |
7596634 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 32; Significance: 0.000000009; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 227 - 282
Target Start/End: Complemental strand, 22424445 - 22424390
Alignment:
| Q |
227 |
ttctcaaactcaatgtctttgttcagattatggtggaaaatttcttcaatccattt |
282 |
Q |
| |
|
||||||||||||||| ||||||||| ||| | |||||||||||||| || |||||| |
|
|
| T |
22424445 |
ttctcaaactcaatggctttgttcatatttttgtggaaaatttcttgaagccattt |
22424390 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 46 times since January 2019
Visitors: 5829