View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0778_low_44 (Length: 374)
Name: NF0778_low_44
Description: NF0778
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0778_low_44 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 227; Significance: 1e-125; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 227; E-Value: 1e-125
Query Start/End: Original strand, 8 - 294
Target Start/End: Complemental strand, 54734641 - 54734357
Alignment:
Q |
8 |
cgaagaatataggatttggatgcaaagaaaaggaaggttttggagcacaccactgaaatatcttagcaggtttggagttgtggcagccagcttatgcaga |
107 |
Q |
|
|
|||| ||| ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
54734641 |
cgaaaaatgtaggatttggacgcaaagaaaaggaaggttttggagcacaccactgaaatatcttagcaggtttggagttgtggcagccagcttatgcaga |
54734542 |
T |
 |
Q |
108 |
gttggaaacaagcacagatcatgcaaaacttgactggcaataagcaaaccagtcttgtgcggtctcgtctttgcaattgcaattcttctgaataacaaat |
207 |
Q |
|
|
|||||||||||||||||||||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
54734541 |
gttggaaacaagcacagatcatgcaaaactagactgccaataagcaaaccagtcttgtgcggtctcgtctttgcaattgcaattcttctgaataacaaat |
54734442 |
T |
 |
Q |
208 |
tatcattaatgaaaaagatagttcaaaatcttttannnnnnnnaaggaagttaaaaatcttttatttcctttaaatattattgtata |
294 |
Q |
|
|
|||||||||||||||||||||||||||||||||| |||||||| |||||||||||||||||||||||||||||||||| |
|
|
T |
54734441 |
tatcattaatgaaaaagatagttcaaaatctttt--tttttttaaggaagtccaaaatcttttatttcctttaaatattattgtata |
54734357 |
T |
 |
Back To:
[
HSP Overview ] [
Target Overview ] [
Alignment Overview ]
© Oklahoma State University