View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0778_low_46 (Length: 363)
Name: NF0778_low_46
Description: NF0778
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0778_low_46 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 150; Significance: 3e-79; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 150; E-Value: 3e-79
Query Start/End: Original strand, 104 - 282
Target Start/End: Original strand, 13333116 - 13333294
Alignment:
| Q |
104 |
atctatataataactaagaaaatattatatcaatagtcacactaacaaagtactggtgtgcatgcaaacaatattgttgcattagttttaccaatattaa |
203 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13333116 |
atctatataataattaagaaaatattatatcaatagtcacaccaacaaagtactggtgtgcatgcaaacaatattgttgcattagttttaccaatattaa |
13333215 |
T |
|
| Q |
204 |
taattattctgcnnnnnnncaaccttataaaatccaaatacaaaaagcctatatatagatggattaacccctttgctct |
282 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13333216 |
taattattctgcaaaaaaacaaccttataaaatccaaatacaaaaagcctatatatagatggattaacccctttgctct |
13333294 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 232 - 280
Target Start/End: Original strand, 13308081 - 13308128
Alignment:
| Q |
232 |
aaaatccaaatacaaaaagcctatatatagatggattaacccctttgct |
280 |
Q |
| |
|
|||||| |||||||||| ||||||||||||||||| ||| ||||||||| |
|
|
| T |
13308081 |
aaaatcgaaatacaaaa-gcctatatatagatggactaatccctttgct |
13308128 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 58 times since January 2019
Visitors: 5846