View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0778_low_51 (Length: 346)
Name: NF0778_low_51
Description: NF0778
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0778_low_51 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 256; Significance: 1e-142; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 256; E-Value: 1e-142
Query Start/End: Original strand, 7 - 326
Target Start/End: Original strand, 7027648 - 7027963
Alignment:
| Q |
7 |
gaagcaaagggtaa-cagtgttgctactacgcagaagaagacacataacacaagcacaaagaaattggcgttacccattgcacctttctttcaatttgtt |
105 |
Q |
| |
|
|||||||||||||| |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7027648 |
gaagcaaagggtaaacagtgttgttactacgcagaagaagacacataacacaagcacaaagaaattggcgttacccattgcacctttctttcaatttgtt |
7027747 |
T |
 |
| Q |
106 |
ccattgaaatcaatctcacaatggaaccagcaacttcttcttacaaggtaacaccactttctttctttctttcaatttagggtttccattctccataatc |
205 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |||||||||| ||| ||||||||| |
|
|
| T |
7027748 |
ccattgaaatcaatctcacaatggaaccagcaacttcttcttacagggtaacaccactttctttctttc----aatttagggtgaa-attttccataatc |
7027842 |
T |
 |
| Q |
206 |
attcaattcgcgctatttgcagattattttgggttcttcctccgttgcacgccgcaatattttatcccaaatgggataccaattcacattaatggtacat |
305 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7027843 |
attcaattcgcgctatttgcagattattttgggttcttcctccgttgcacgccgcaagattttatcccaaatgggataccaattcacattaatggtacat |
7027942 |
T |
 |
| Q |
306 |
tcatttgattgcttctatcct |
326 |
Q |
| |
|
| ||||||||||||||||||| |
|
|
| T |
7027943 |
tgatttgattgcttctatcct |
7027963 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University